Recall that in prokaryotic genomes, the sequence coding for a protein occurs as one contiguous open reading frame, and that an open reading frame begins with the start codon ATG (methionine) in most species and ends with a stop codon TAA, TAG, or TGA.
For example, the DNA sequence of Bacteriophage -X174, which was the first genome to be sequenced, has 117 open reading frames (11 of which are protein coding genes) within a circular single strand of 5,386 nucleotides.
Write code for the gene finding problem. The program must implement and use the GENE-FINDING function in the pseudocode discussed in class, which is iterative and is not allowed to perform input/output operations. Make one submission with Python code and another submission with C++ code.
The input is a string over the alphabet .
The output is a minimal substring of (an open reading frame) from a start codon to a stop codon.
Input
GGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAA
Output
ATGTGGCTAAATACGTTAACAAAAAGTCAGATATGGACCTTGCTGCTAAAGGTCTAG