Genetic code

Write a program that converts chains of messenger RNA (derived sequences
of DNA) to proteins using the genetic code.

The genetic code is a set of rules that translates the sequences of
messenger RNA to proteins. A sequence of messenger RNA is a sequence of
bases. There are four possible bases: @A@, @C@, @G@ and @U@. The bases
of genes are grouped in threes forming codons. Every codon corresponds
to an amino acid. A protein is a sequence of amino acids.

The following figure shows the genetic code. It can be seen, for
instance, that the codon @GGA@ corresponds to glycine and that the codon
@AUC@ corresponds to isoleucine. There are also three special codons,
marked with the stop symbol, that do not encode any amino acid, but
indicate the end of codification. Once a stop codon is found, the gene
is finished (an AUG does not have to be searched after). Moreover,
proteins only start to be synthesized from the first appearance of the
codon @AUG@. Thus, an imaginari gene @GCCAAUGACUAAGGCCUAAAGA@ would
correspond to the protein @ThrLysAla@.

[image]

Input

Input is a gene obtained from the GeneBank, a genome bank that can be
consulted on the Internet. This gene consists of a brief finished in ‘:’
followed by the sequence of messenger RNA bases corresponding to this
gene. It always appears a @AUG@ codon before a Stop codon.

Output

The output must be the protein synthesized by this gene according the
previous rules of the genetic code. Your program must print the sequence
using the standard names of three letters for each amino acid. For each
line, print 26 amino acids, except the last one, that may contain less.

Observation

The second instance is an artificial extract of genome of hepatitis C
virus. The private test datas contain the complete genome (10
kilobases).

Problem information

Author: Unknown
Translator: Carlos Molina

Generation: 2026-01-25T10:29:56.390Z

© Jutge.org, 2006–2026.
https://jutge.org
